Incorporation of a fluorescent nucleotide into oligoribonucleotides
CJ Adams, JB Murray, JRP Arnold, PG Stockley
Index: Adams, Chris J.; Murray, James B.; Arnold, John R.P.; Stockley, Peter G. Tetrahedron Letters, 1994 , vol. 35, # 10 p. 1597 - 1600
Full Text: HTML
Citation Number: 25
Abstract
Abstract The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4H C) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA [4H C] UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate ...
Related Articles:
[Bean, Heather D.; Sheng, Yinghong; Collins, James P.; Anet, Frank A. L.; Leszczynski, Jerzy; Hud, Nicholas V. Journal of the American Chemical Society, 2007 , vol. 129, # 31 p. 9556 - 9557]
[Battenberg, Oliver A.; Nodwell, Matthew B.; Sieber, Stephan A. Journal of Organic Chemistry, 2011 , vol. 76, # 15 p. 6075 - 6087]
[Battenberg, Oliver A.; Nodwell, Matthew B.; Sieber, Stephan A. Journal of Organic Chemistry, 2011 , vol. 76, # 15 p. 6075 - 6087]