Telavancin (TD-6424) is a semisynthetic lipoglycopeptide vancomycin-derivative, is a novel antimicrobial agent developed by Theravance for overcoming resistant Gram-positive bacterial infections, specifically methicillin-resistant Staphylococcus aureus (MRSA). Telavancin disrupts cell membrane integrity, can be used for research of complicated skin and skin structure infections (cSSSIs) caused by Gram-positive bacteria[1].
Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM[1].
(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].
6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].
Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].
Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].
Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].
A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].
2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].
Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains[1].
Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections[1].
Ribostamycin is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies
Tulathromycin B (CP 547272) is an isomer of Tulathromycin (a macrolide antibiotic)[1].
Ludaconitine, isolated from Aconitum spicatum (Bruhl) Stapf, exhibits antileishmanial activity with an IC50 of 36.10 μg/mL[1].
Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).
Dermaseptin-S2 is an antimicrobial peptide derived from frog skin against filamentous fungi[1].
Cinnamaldehyde is a major and a bioactive compound isolated from the leaves of Cinnamomum osmophloeum kaneh. Cinnamaldehyde is a cytokine production inhibitor. Cinnamaldehyde has anti-bacteria, anti-oxidation, and anti-inflammatory properties[1].
Loflucarban (Fluonilid) is a potent antimycotic agent. Loflucarban can be used for the research of the ear infections[1].
Chloramultilide B is a lindenane dimer that can be isolated from Chloranthus serratus. Chloramultilide B has inhibitory activities against Candida albicans and C.parapsilosis with a MIC value of 0.068 μM[1].
Clazakizumab is a monoclonal antibody with high affinity and specificity for the IL-6 (interleukin-6) cytokine. Clazakizumab may be helpful in inhibiting the cytokine response to SARS-CoV-2 in COVID-19. Clazakizumab can be used for the research of psoriatic arthritis (PsA) and renal antibody-mediated rejection[1][2].
9H-Purin-6-amine, 9-(1E)-1-propen-1-yl- is a mutagenic impurity in tenofovir disoproxil fumarate. Tenofovir is an antiretroviral drug known as nucleotide analogue reverse transcriptase inhibitors, which block reverse transcriptase, a crucial virus enzyme in HIV-1 and HBV.
Sulfaclozine sodium (Sulfachloropyrazine sodium) is an efficacious sulphonamide derivative with antibacterial and anticoccidial effects. Sulfaclozine sodium is commonly used for the treatment of various poultry diseases (particularly, collibacteriosis, fowl cholera and coccidiosis)[1].
Diethyl butylmalonate exhibits toxicity to T. pyriformis, with a log(IGC50-1) of 0.557[1].
Dexelvucitabine (Reverset; d-d4FC), a Cytidine (HY-B0158) analog, is an orally active nucleoside reverse transcriptase inhibitor. Dexelvucitabine is a powerful drug against HIV-1-resistant viruses containing a thymidine analog and/or M184V mutation in the viral polymerase. Dexelvucitabine is a 2′-Deoxycytidine antiretroviral agent[1].
Valtrate hydrine B4 is a natural compound with antifungal activities[1].
SARS-CoV-2-IN-63 (Compound R3e) is an inhibitor of SARS-CoV-2 replication and has low cytotoxicity. SARS-CoV-2-IN-63 inhibits viral replication in Vero E6 cells and Calu-3 cells, with EC50 values of 1.99 μM and 1.92 μM, respectively[1].
Sarecycline hydrochloride is a narrow-spectrum tetracycline-class antibiotic. Sarecycline hydrochloride possesses anti-inflammatory properties and potent activity against Gram-positive bacteria, including activity against multiple strains of Cutibacterium acnes. Sarecycline hydrochloride interferes with tRNA accommodation and tethers mRNA to the 70S ribosome[1][2][3].
Salvinolone is active against methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus (VRE). Salvinolone shows cytotoxic activity with an IC50 of 47.6 μM against the HL-60 tumor cell line for 72 h[1][2].