Benzisothiazolinone-13C5 (1,2-Benzothiazol-3-one-13C5) is a 13C-labeled Benzisothiazolinone. Benzisothiazolinone is widely used as an antiseptic and antibacterial agent[1].
Urease-IN-7 (Compound 5k) is a competitive Urease inhibitor (IC50: 3.33 μM, Ki: 3.62 μM). Urease-IN-7 can be used for research of peptic and gastric ulcers[1].
Sordarin is a potent diphthamide-dependent eEF2 inhibitor with antifungal properties. Sordarin targets eEF2 so as to inhibit protein translation by blocking eEF2-mediated translocation of tRNAs. Sordarin inhibits translation specifically in certain fungi (e.g. C. albicans, C. glabrata, and C. neoformans) while unable to do so in some other fungal species (e.g. Candida parapsilosis and Candida lusitaniae)[1][2].
Cefoselis is a widely used beta-lactam antibiotic.Target: AntibacterialCefoselis, a new parenteral cephalosporin, was active against clinical isolates of both gram-positive and gram-negative aerobic bacteria. The activity of Cefoselis was similar to that of cefpirome and cefepime and generally superior to that of ceftazidime. Cefoselis showed potent antibacterial activity against Hemophilus influenzae and Moraxella catarrhalis.Cefoselis was highly active against MSSA and MSCNS. Cefoselis was poor in the activity against MRSA,MRCNS,PRSP and Enterococcus faecalis,and no activity for Enterococcus faecium.
Antiviral agent 30 (Example 118) is an antiviral agent. Antiviral agent 30 is active against HCV and RSV (IC50: > 25μM)[1].
Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM[1].
(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].
6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].
Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].
2,5-Dihydroxybenzaldehyde (Gentisaldehyde) is a naturally occurring antimicrobial that inhibits the growth of Mycobacterium avium subsp. paratuberculosis. 2,5-Dihydroxybenzaldehyde is active against S. aureus strains with a MIC50 of 500 mg/L[1][2].
Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].
Pseudin-2, an AMP thast could be isolated from the skin of the South American paradoxical frog Pseudis paradoxa, exert a potent growth inhibitory effect against Gram-negative bacteria[1].
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].
Z-LVG-CHN2 is a cell-permeable and irreversible inhibitor of cysteine proteinase. Z-LVG-CHN2 is a tripeptide derivative and mimics part of the human cysteine proteinase-binding center. Z-LVG-CHN2 displays an inhibition on HSV whereas no significant effect on poliovirus replication. Z-LVG-CHN2 effectively blocks SARS-COV-2 replication (EC50=190 nM) via inhibition of SARS-COV-2 3CL pro protease[3].
Sulfathiazole is an organosulfur compound that has been used as a short-acting sulfa drug.Target: AntibacterialSulfathiazole (20 μg/L) starts to be degraded between day 31 and day 38 in one of the two batch reactors containing different wastewater matrices. Sulfathiazole is degraded at a substantially faster rate than sulfamethoxazole or sulfamethazine in the nitrification process (S3) [1]. Recovery from spiked manure slurry samples is 64% for Sulfathiazole at pH 9. Sulfathiazole has acidity constant of pKa of 7.1and retention times (tR) of 7.8. S/N values for Sulfathiazole are above 100 at the 1 mg/kg level [2]. Sulfathiazole sorption to inorganic sorbents exhibits pronounced pH dependence consistent with sorbate speciation and sorbent charge properties. Sulfathiazole cations are most important for sorption to clay minerals, followed by neutral species [3].
Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].
BKI-1369 is a bumped kinase inhibitor (BKI). BKI-1369 increases human Ether-a-go-go-related gene (hERG)-inhibitory activity with an IC50 of 1.52 μM. BKI-1369 reduces the parasite burden and diseases severity in the gnotobiotic pig model. BKI-1369 has been well characterized for potency, stability, metabolism, toxicity, pharmacokinetics and is potent against C. parvum in infected mice and calves[1].
Merafloxacin (CI-934), a fluoroquinolone antibacterial agent, is a selective programmed -1 ribosomal frameshifting (-1 PRF) inhibitor of beta coronaviruses. Merafloxacin exhibits in vitro activity against gram-positive and gram-negative bacteria[1][2].
A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].
2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].
Zoxamide (RH-7281) is an oomycete fungicide. Zoxamide arrests nuclear division in Phytophthora capsici germlings and destroyed the microtubule cytoskeleton[1][2].
Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains[1].
Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections[1].
c[Arg-Arg-Arg-Arg-Nal-Nal-Nal] (Compound 9C) shows broad-spectrum activity against drug-resistant Gram-positive and Gram-negative bacteria, with MICs of 3.1, 3,1, 12.5, and 25 μg/mL for MRSA (ATCC BAA-1556), S. aureus (ATCC 29213), P. aeruginosa (ATCC 27883), and E. coli (ATCC 25922), respectively[1].
Ribostamycin is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies
Fangchinoline is isolated from Stephania tetrandra with extensive biological activities, such as enhancing immunity, anti-inflammatory sterilization and anti-atherosclerosis. Fangchinoline, a novel HIV-1 inhibitor, inhibits HIV-1 replication by impairing gp160 proteolytic processing[1]. Fangchinoline targets Focal adhesion kinase (FAK) and suppresses FAK-mediated signaling pathway in tumor cells which highly expressed FAK[2]. Fangchinoline induces apoptosis and adaptive autophagy in bladder cancer[3].
Tulathromycin B (CP 547272) is an isomer of Tulathromycin (a macrolide antibiotic)[1].
HIV-1 protease-IN-1 (Compound 1e) is a potent inhibitor of HIV-1 protease with an IC50 of 90 pM. HIV-1 protease-IN-1 demonstrates antiviral activity with EC50 value of 89 nM against B-HIV. HIV-1 protease-IN-1 exhibits activity with EC50 value of 13.59 nM against C-HIV strain ZM246. HIV-1 protease-IN-1 shows remarkable activity with EC50 value of 8.23 nM against C-HIV strain Indie[1].
Ludaconitine, isolated from Aconitum spicatum (Bruhl) Stapf, exhibits antileishmanial activity with an IC50 of 36.10 μg/mL[1].