Anti-infectives are drugs that can either kill an infectious agent or inhibit it from spreading. Anti-infectives include antibiotics and antibacterials, antifungals, antivirals and antiprotozoals.

Antibiotics specifically treat infections caused by bacteria, most commonly used types of antibiotics are: Aminoglycosides, Penicillins, Fluoroquinolones, Cephalosporins, Macrolides, and Tetracyclines. New other approaches such as photodynamic therapy (PDT) and antibacterial peptides have been considered as alternatives to kill bacteria.

The high rates of morbidity and mortality caused by fungal infections are associated with the current limited antifungal arsenal and the high toxicity of the compounds. The most common antifungal targets include fungal RNA synthesis and cell wall and membrane components, though new antifungal targets are being investigated.

Viral infections occur when viruses enter cells in the body and begin reproducing, often causing illness. Viruses are classified as DNA viruses or RNA viruses, RNA viruses include retroviruses, such as HIV, are prone to mutate. The currently available antiviral drugs target 4 main groups of viruses: herpes, hepatitis, HIV and influenza viruses. Drug resistance in the clinical utility of antiviral drugs has raised an urgent need for developing new antiviral drugs.

Antiprotozoal drugs are medicines that treat infections caused by protozoa. Of which, malaria remains a major world health problem following the emergence and spread of Plasmodium falciparum that is resistant to the majority of antimalarial drugs. At present, antimalarial discovery approaches have been studied, such as the discovery of antimalarials from natural sources, chemical modifications of existing antimalarials, the development of hybrid compounds, testing of commercially available drugs that have been approved for human use for other diseases and molecular modelling using virtual screening technology and docking.

References:
[1] Scorzoni L, et al. Front Microbiol. 2017 Jan 23;8:36.
[2] Dehghan Esmatabadi MJ, et al. Cell Mol Biol (Noisy-le-grand). 2017 Feb 28;63(2):40-48.
[3] Raymund R, et al. Mayo Clin Proc. 2011 Oct; 86(10):1009-1026.
[4] Aguiar AC, et al. Mem Inst Oswaldo Cruz. 2012 Nov;107(7):831-45.


Anti-infection >
Arenavirus Bacterial CMV Enterovirus Filovirus Fungal HBV HCV HIV HSV Influenza Virus Parasite Reverse Transcriptase RSV SARS-CoV
Antibody-drug Conjugate >
ADC Cytotoxin ADC Linker Drug-Linker Conjugates for ADC PROTAC-linker Conjugate for PAC
Apoptosis >
Apoptosis Bcl-2 Family c-Myc Caspase DAPK Ferroptosis IAP MDM-2/p53 PKD RIP kinase Survivin Thymidylate Synthase TNF Receptor
Autophagy >
Autophagy LRRK2 ULK Mitophagy
Cell Cycle/DNA Damage >
Antifolate APC ATM/ATR Aurora Kinase Casein Kinase CDK Checkpoint Kinase (Chk) CRISPR/Cas9 Deubiquitinase DNA Alkylator/Crosslinker DNA-PK DNA/RNA Synthesis Eukaryotic Initiation Factor (eIF) G-quadruplex Haspin Kinase HDAC HSP IRE1 Kinesin LIM Kinase (LIMK) Microtubule/Tubulin Mps1 Nucleoside Antimetabolite/Analog p97 PAK PARP PERK Polo-like Kinase (PLK) PPAR RAD51 ROCK Sirtuin SRPK Telomerase TOPK Topoisomerase Wee1
Cytoskeleton >
Arp2/3 Complex Dynamin Gap Junction Protein Integrin Kinesin Microtubule/Tubulin Mps1 Myosin PAK
Epigenetics >
AMPK Aurora Kinase DNA Methyltransferase Epigenetic Reader Domain HDAC Histone Acetyltransferase Histone Demethylase Histone Methyltransferase JAK MicroRNA PARP PKC Sirtuin Protein Arginine Deiminase
GPCR/G Protein >
5-HT Receptor Adenosine Receptor Adenylate Cyclase Adiponectin Receptor Adrenergic Receptor Angiotensin Receptor Bombesin Receptor Bradykinin Receptor Cannabinoid Receptor CaSR CCR CGRP Receptor Cholecystokinin Receptor CRFR CXCR Dopamine Receptor EBI2/GPR183 Endothelin Receptor GHSR Glucagon Receptor Glucocorticoid Receptor GNRH Receptor GPCR19 GPR109A GPR119 GPR120 GPR139 GPR40 GPR55 GPR84 Guanylate Cyclase Histamine Receptor Imidazoline Receptor Leukotriene Receptor LPL Receptor mAChR MCHR1 (GPR24) Melatonin Receptor mGluR Motilin Receptor Neurokinin Receptor Neuropeptide Y Receptor Neurotensin Receptor Opioid Receptor Orexin Receptor (OX Receptor) Oxytocin Receptor P2Y Receptor Prostaglandin Receptor Protease-Activated Receptor (PAR) Ras RGS Protein Sigma Receptor Somatostatin Receptor TSH Receptor Urotensin Receptor Vasopressin Receptor Melanocortin Receptor
Immunology/Inflammation >
Aryl Hydrocarbon Receptor CCR Complement System COX CXCR FLAP Histamine Receptor IFNAR Interleukin Related IRAK MyD88 NO Synthase NOD-like Receptor (NLR) PD-1/PD-L1 PGE synthase Salt-inducible Kinase (SIK) SPHK STING Thrombopoietin Receptor Toll-like Receptor (TLR) Arginase
JAK/STAT Signaling >
EGFR JAK Pim STAT
MAPK/ERK Pathway >
ERK JNK KLF MAP3K MAP4K MAPKAPK2 (MK2) MEK Mixed Lineage Kinase MNK p38 MAPK Raf Ribosomal S6 Kinase (RSK)
Membrane Transporter/Ion Channel >
ATP Synthase BCRP Calcium Channel CFTR Chloride Channel CRAC Channel CRM1 EAAT2 GABA Receptor GlyT HCN Channel iGluR Monoamine Transporter Monocarboxylate Transporter Na+/Ca2+ Exchanger Na+/HCO3- Cotransporter Na+/K+ ATPase nAChR NKCC P-glycoprotein P2X Receptor Potassium Channel Proton Pump SGLT Sodium Channel TRP Channel URAT1
Metabolic Enzyme/Protease >
15-PGDH 5 alpha Reductase 5-Lipoxygenase Acetyl-CoA Carboxylase Acyltransferase Adenosine Deaminase Adenosine Kinase Aldehyde Dehydrogenase (ALDH) Aldose Reductase Aminopeptidase Angiotensin-converting Enzyme (ACE) ATGL ATP Citrate Lyase Carbonic Anhydrase Carboxypeptidase Cathepsin CETP COMT Cytochrome P450 Dipeptidyl Peptidase Dopamine β-hydroxylase E1/E2/E3 Enzyme Elastase Enolase FAAH FABP Factor Xa Farnesyl Transferase Fatty Acid Synthase (FAS) FXR Glucokinase GSNOR Gutathione S-transferase HCV Protease Hexokinase HIF/HIF Prolyl-Hydroxylase HIV Integrase HIV Protease HMG-CoA Reductase (HMGCR) HSP Indoleamine 2,3-Dioxygenase (IDO) Isocitrate Dehydrogenase (IDH) Lactate Dehydrogenase LXR MAGL Mineralocorticoid Receptor Mitochondrial Metabolism MMP Nampt NEDD8-activating Enzyme Neprilysin PAI-1 PDHK PGC-1α Phosphatase Phosphodiesterase (PDE) Phospholipase Procollagen C Proteinase Proteasome Pyruvate Kinase RAR/RXR Renin ROR Ser/Thr Protease SGK Stearoyl-CoA Desaturase (SCD) Thrombin Tryptophan Hydroxylase Tyrosinase Xanthine Oxidase
Neuronal Signaling >
5-HT Receptor AChE Adenosine Kinase Amyloid-β Beta-secretase CaMK CGRP Receptor COMT Dopamine Receptor Dopamine Transporter FAAH GABA Receptor GlyT iGluR Imidazoline Receptor mAChR Melatonin Receptor Monoamine Oxidase nAChR Neurokinin Receptor Opioid Receptor Serotonin Transporter γ-secretase
NF-κB >
NF-κB IKK Keap1-Nrf2 MALT1
PI3K/Akt/mTOR >
Akt AMPK ATM/ATR DNA-PK GSK-3 MELK mTOR PDK-1 PI3K PI4K PIKfyve PTEN
PROTAC >
PROTAC E3 Ligase Ligand-Linker Conjugate Ligand for E3 Ligase PROTAC Linker PROTAC-linker Conjugate for PAC
Protein Tyrosine Kinase/RTK >
Ack1 ALK Bcr-Abl BMX Kinase Btk c-Fms c-Kit c-Met/HGFR Discoidin Domain Receptor DYRK EGFR Ephrin Receptor FAK FGFR FLT3 IGF-1R Insulin Receptor IRAK Itk PDGFR PKA Pyk2 ROS Src Syk TAM Receptor Trk Receptor VEGFR
Stem Cell/Wnt >
Casein Kinase ERK Gli GSK-3 Hedgehog Hippo (MST) JAK Notch Oct3/4 PKA Porcupine ROCK sFRP-1 Smo STAT TGF-beta/Smad Wnt YAP β-catenin γ-secretase
TGF-beta/Smad >
TGF-beta/Smad PKC ROCK TGF-β Receptor
Vitamin D Related >
VD/VDR
Others >
Androgen Receptor Aromatase Estrogen Receptor/ERR Progesterone Receptor Thyroid Hormone Receptor Others

Benzisothiazolinone-13C5

Benzisothiazolinone-13C5 (1,2-Benzothiazol-3-one-13C5) is a 13C-labeled Benzisothiazolinone. Benzisothiazolinone is widely used as an antiseptic and antibacterial agent[1].

  • CAS Number: 1329616-16-1
  • MF: C7H5NOS
  • MW: 151.19
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Urease-IN-7

Urease-IN-7 (Compound 5k) is a competitive Urease inhibitor (IC50: 3.33 μM, Ki: 3.62 μM). Urease-IN-7 can be used for research of peptic and gastric ulcers[1].

  • CAS Number: 1129406-54-7
  • MF: C16H10BrFN4S
  • MW: 389.24
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Sordarin sodium

Sordarin is a potent diphthamide-dependent eEF2 inhibitor with antifungal properties. Sordarin targets eEF2 so as to inhibit protein translation by blocking eEF2-mediated translocation of tRNAs. Sordarin inhibits translation specifically in certain fungi (e.g. C. albicans, C. glabrata, and C. neoformans) while unable to do so in some other fungal species (e.g. Candida parapsilosis and Candida lusitaniae)[1][2].

  • CAS Number: 463356-00-5
  • MF: C27H39NaO8
  • MW: 514.58
  • Catalog: Fungal
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Cefoselis sulfate

Cefoselis is a widely used beta-lactam antibiotic.Target: AntibacterialCefoselis, a new parenteral cephalosporin, was active against clinical isolates of both gram-positive and gram-negative aerobic bacteria. The activity of Cefoselis was similar to that of cefpirome and cefepime and generally superior to that of ceftazidime. Cefoselis showed potent antibacterial activity against Hemophilus influenzae and Moraxella catarrhalis.Cefoselis was highly active against MSSA and MSCNS. Cefoselis was poor in the activity against MRSA,MRCNS,PRSP and Enterococcus faecalis,and no activity for Enterococcus faecium.

  • CAS Number: 122841-12-7
  • MF: C19H24N8O10S3
  • MW: 620.636
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Antiviral agent 30

Antiviral agent 30 (Example 118) is an antiviral agent. Antiviral agent 30 is active against HCV and RSV (IC50: > 25μM)[1].

  • CAS Number: 381731-49-3
  • MF: C21H32N2O3S
  • MW: 392.56
  • Catalog: HCV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Gomisin L1

Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM[1].

  • CAS Number: 82467-50-3
  • MF: C22H26O6
  • MW: 386.438
  • Catalog: HIV
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 568.6±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 297.7±30.1 °C

(+)-Pinoresinol

(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].

  • CAS Number: 4263-88-1
  • MF: C20H22O6
  • MW: 358.39
  • Catalog: Fungal
  • Density: 1.3±0.1 g/cm3
  • Boiling Point: 556.5±50.0 °C at 760 mmHg
  • Melting Point: 144-145℃
  • Flash Point: 290.4±30.1 °C

4-Chloro-7-(2-deoxy-2-fluoro-beta-D-arabinofuranosyl)-7H-pyrrolo[2.3-d]pyrimidine

6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].

  • CAS Number: 169516-60-3
  • MF: C11H11ClFN3O3
  • MW: 287.675
  • Catalog: HCV
  • Density: 1.8±0.1 g/cm3
  • Boiling Point: 548.4±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 285.5±30.1 °C

Oseltamivir-acetate

Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].

  • CAS Number: 1191921-01-3
  • MF: C18H30N2O5
  • MW: 354.44
  • Catalog: Influenza Virus
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

2,5-Dihydroxybenzaldehyde

2,5-Dihydroxybenzaldehyde (Gentisaldehyde) is a naturally occurring antimicrobial that inhibits the growth of Mycobacterium avium subsp. paratuberculosis. 2,5-Dihydroxybenzaldehyde is active against S. aureus strains with a MIC50 of 500 mg/L[1][2].

  • CAS Number: 1194-98-5
  • MF: C7H6O3
  • MW: 138.121
  • Catalog: Bacterial
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 276.1±20.0 °C at 760 mmHg
  • Melting Point: 97-99 °C(lit.)
  • Flash Point: 135.1±18.3 °C

Brilacidin tetrahydrochloride

Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].

  • CAS Number: 1224095-99-1
  • MF: C40H54Cl4F6N14O6
  • MW: 1082.75000
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Pseudin-2 trifluoroacetate salt

Pseudin-2, an AMP thast could be isolated from the skin of the South American paradoxical frog Pseudis paradoxa, exert a potent growth inhibitory effect against Gram-negative bacteria[1].

  • CAS Number: 388602-02-6
  • MF: C122H202N36O32
  • MW: 2685.1
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Bepirovirsen

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

FPI-1602

FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].

  • CAS Number: 1452460-31-9
  • MF: C11H17N5O7S
  • MW: 363.35
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Z-LVG-CHN2

Z-LVG-CHN2 is a cell-permeable and irreversible inhibitor of cysteine proteinase. Z-LVG-CHN2 is a tripeptide derivative and mimics part of the human cysteine proteinase-binding center. Z-LVG-CHN2 displays an inhibition on HSV whereas no significant effect on poliovirus replication. Z-LVG-CHN2 effectively blocks SARS-COV-2 replication (EC50=190 nM) via inhibition of SARS-COV-2 3CL pro protease[3].

  • CAS Number: 119670-30-3
  • MF: C22H31N5O5
  • MW: 445.51
  • Catalog: HSV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Sulfathiazole

Sulfathiazole is an organosulfur compound that has been used as a short-acting sulfa drug.Target: AntibacterialSulfathiazole (20 μg/L) starts to be degraded between day 31 and day 38 in one of the two batch reactors containing different wastewater matrices. Sulfathiazole is degraded at a substantially faster rate than sulfamethoxazole or sulfamethazine in the nitrification process (S3) [1]. Recovery from spiked manure slurry samples is 64% for Sulfathiazole at pH 9. Sulfathiazole has acidity constant of pKa of 7.1and retention times (tR) of 7.8. S/N values for Sulfathiazole are above 100 at the 1 mg/kg level [2]. Sulfathiazole sorption to inorganic sorbents exhibits pronounced pH dependence consistent with sorbate speciation and sorbent charge properties. Sulfathiazole cations are most important for sorption to clay minerals, followed by neutral species [3].

  • CAS Number: 72-14-0
  • MF: C9H9N3O2S2
  • MW: 255.317
  • Catalog: Bacterial
  • Density: 1.6±0.1 g/cm3
  • Boiling Point: 479.5±47.0 °C at 760 mmHg
  • Melting Point: 202.5ºC
  • Flash Point: 243.8±29.3 °C

Penicillin G benzathine tetrahydrate

Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].

  • CAS Number: 41372-02-5
  • MF: C48H64N6O12S2
  • MW: 981.185
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: 1299.8ºC at 760 mmHg
  • Melting Point: 123-124°C
  • Flash Point: 739.9ºC

BKI-1369

BKI-1369 is a bumped kinase inhibitor (BKI). BKI-1369 increases human Ether-a-go-go-related gene (hERG)-inhibitory activity with an IC50 of 1.52 μM. BKI-1369 reduces the parasite burden and diseases severity in the gnotobiotic pig model. BKI-1369 has been well characterized for potency, stability, metabolism, toxicity, pharmacokinetics and is potent against C. parvum in infected mice and calves[1].

  • CAS Number: 1951431-22-3
  • MF: C23H27N7O
  • MW: 417.51
  • Catalog: Parasite
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Merafloxacin

Merafloxacin (CI-934), a fluoroquinolone antibacterial agent, is a selective programmed -1 ribosomal frameshifting (-1 PRF) inhibitor of beta coronaviruses. Merafloxacin exhibits in vitro activity against gram-positive and gram-negative bacteria[1][2].

  • CAS Number: 91188-00-0
  • MF: C19H23F2N3O3
  • MW: 379.40100
  • Catalog: SARS-CoV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

A3N19

A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].

  • CAS Number: 2249755-49-3
  • MF: C31H31N9O2S
  • MW: 593.70
  • Catalog: HIV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

2-ETHYL-6-METHYLPHENOL

2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].

  • CAS Number: 1687-64-5
  • MF: C9H12O
  • MW: 136.19100
  • Catalog: Bacterial
  • Density: 0.994g/cm3
  • Boiling Point: 209.8ºC at 760mmHg
  • Melting Point: N/A
  • Flash Point: 90.7ºC

zoxamide

Zoxamide (RH-7281) is an oomycete fungicide. Zoxamide arrests nuclear division in Phytophthora capsici germlings and destroyed the microtubule cytoskeleton[1][2].

  • CAS Number: 156052-68-5
  • MF: C14H16Cl3NO2
  • MW: 336.64
  • Catalog: Fungal
  • Density: 1.3±0.1 g/cm3
  • Boiling Point: 415.4±45.0 °C at 760 mmHg
  • Melting Point: 159.5-161ºC
  • Flash Point: 205.0±28.7 °C

Napyradiomycin A1

Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains[1].

  • CAS Number: 103106-24-7
  • MF: C25H30Cl2O5
  • MW: 481.40900
  • Catalog: Bacterial
  • Density: 1.31g/cm3
  • Boiling Point: 642.5ºC at 760mmHg
  • Melting Point: N/A
  • Flash Point: 342.4ºC

Antimicrobial agent-3

Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections[1].

  • CAS Number: 1902712-34-8
  • MF: C14H11N3OS
  • MW: 269.32
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

c[Arg-Arg-Arg-Arg-Nal-Nal-Nal]

c[Arg-Arg-Arg-Arg-Nal-Nal-Nal] (Compound 9C) shows broad-spectrum activity against drug-resistant Gram-positive and Gram-negative bacteria, with MICs of 3.1, 3,1, 12.5, and 25 μg/mL for MRSA (ATCC BAA-1556), S. aureus (ATCC 29213), P. aeruginosa (ATCC 27883), and E. coli (ATCC 25922), respectively[1].

  • CAS Number: 2619854-01-0
  • MF: C63H81N19O7
  • MW: 1216.44
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Ribostamycin sulfate

Ribostamycin is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies

  • CAS Number: 53797-35-6
  • MF: C17H36N4O14S
  • MW: 552.551
  • Catalog: Bacterial
  • Density: 1.6g/cm3
  • Boiling Point: 907.6ºC at 760 mmHg
  • Melting Point: 175-180ºC
  • Flash Point: 502.7ºC

Fangchinoline

Fangchinoline is isolated from Stephania tetrandra with extensive biological activities, such as enhancing immunity, anti-inflammatory sterilization and anti-atherosclerosis. Fangchinoline, a novel HIV-1 inhibitor, inhibits HIV-1 replication by impairing gp160 proteolytic processing[1]. Fangchinoline targets Focal adhesion kinase (FAK) and suppresses FAK-mediated signaling pathway in tumor cells which highly expressed FAK[2]. Fangchinoline induces apoptosis and adaptive autophagy in bladder cancer[3].

  • CAS Number: 436-77-1
  • MF: C37H40N2O6
  • MW: 608.723
  • Catalog: HIV
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 709.7±60.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 383.0±32.9 °C

Tulathromycin B

Tulathromycin B (CP 547272) is an isomer of Tulathromycin (a macrolide antibiotic)[1].

  • CAS Number: 280755-12-6
  • MF: C41H79N3O12
  • MW: 806.079
  • Catalog: Bacterial
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 870.5±65.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 480.3±34.3 °C

HIV-1 protease-IN-1

HIV-1 protease-IN-1 (Compound 1e) is a potent inhibitor of HIV-1 protease with an IC50 of 90 pM. HIV-1 protease-IN-1 demonstrates antiviral activity with EC50 value of 89 nM against B-HIV. HIV-1 protease-IN-1 exhibits activity with EC50 value of 13.59 nM against C-HIV strain ZM246. HIV-1 protease-IN-1 shows remarkable activity with EC50 value of 8.23 nM against C-HIV strain Indie[1].

  • CAS Number: 2765293-30-7
  • MF: C25H35N3O6S
  • MW: 505.63
  • Catalog: HIV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Ludaconitine

Ludaconitine, isolated from Aconitum spicatum (Bruhl) Stapf, exhibits antileishmanial activity with an IC50 of 36.10 μg/mL[1].

  • CAS Number: 82144-72-7
  • MF: C32H45NO9
  • MW: 587.70
  • Catalog: Parasite
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A