HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.


Anti-infection >
Arenavirus Bacterial CMV Enterovirus Filovirus Fungal HBV HCV HIV HSV Influenza Virus Parasite Reverse Transcriptase RSV SARS-CoV
Antibody-drug Conjugate >
ADC Cytotoxin ADC Linker Drug-Linker Conjugates for ADC PROTAC-linker Conjugate for PAC
Apoptosis >
Apoptosis Bcl-2 Family c-Myc Caspase DAPK Ferroptosis IAP MDM-2/p53 PKD RIP kinase Survivin Thymidylate Synthase TNF Receptor
Autophagy >
Autophagy LRRK2 ULK Mitophagy
Cell Cycle/DNA Damage >
Antifolate APC ATM/ATR Aurora Kinase Casein Kinase CDK Checkpoint Kinase (Chk) CRISPR/Cas9 Deubiquitinase DNA Alkylator/Crosslinker DNA-PK DNA/RNA Synthesis Eukaryotic Initiation Factor (eIF) G-quadruplex Haspin Kinase HDAC HSP IRE1 Kinesin LIM Kinase (LIMK) Microtubule/Tubulin Mps1 Nucleoside Antimetabolite/Analog p97 PAK PARP PERK Polo-like Kinase (PLK) PPAR RAD51 ROCK Sirtuin SRPK Telomerase TOPK Topoisomerase Wee1
Cytoskeleton >
Arp2/3 Complex Dynamin Gap Junction Protein Integrin Kinesin Microtubule/Tubulin Mps1 Myosin PAK
Epigenetics >
AMPK Aurora Kinase DNA Methyltransferase Epigenetic Reader Domain HDAC Histone Acetyltransferase Histone Demethylase Histone Methyltransferase JAK MicroRNA PARP PKC Sirtuin Protein Arginine Deiminase
GPCR/G Protein >
5-HT Receptor Adenosine Receptor Adenylate Cyclase Adiponectin Receptor Adrenergic Receptor Angiotensin Receptor Bombesin Receptor Bradykinin Receptor Cannabinoid Receptor CaSR CCR CGRP Receptor Cholecystokinin Receptor CRFR CXCR Dopamine Receptor EBI2/GPR183 Endothelin Receptor GHSR Glucagon Receptor Glucocorticoid Receptor GNRH Receptor GPCR19 GPR109A GPR119 GPR120 GPR139 GPR40 GPR55 GPR84 Guanylate Cyclase Histamine Receptor Imidazoline Receptor Leukotriene Receptor LPL Receptor mAChR MCHR1 (GPR24) Melatonin Receptor mGluR Motilin Receptor Neurokinin Receptor Neuropeptide Y Receptor Neurotensin Receptor Opioid Receptor Orexin Receptor (OX Receptor) Oxytocin Receptor P2Y Receptor Prostaglandin Receptor Protease-Activated Receptor (PAR) Ras RGS Protein Sigma Receptor Somatostatin Receptor TSH Receptor Urotensin Receptor Vasopressin Receptor Melanocortin Receptor
Immunology/Inflammation >
Aryl Hydrocarbon Receptor CCR Complement System COX CXCR FLAP Histamine Receptor IFNAR Interleukin Related IRAK MyD88 NO Synthase NOD-like Receptor (NLR) PD-1/PD-L1 PGE synthase Salt-inducible Kinase (SIK) SPHK STING Thrombopoietin Receptor Toll-like Receptor (TLR) Arginase
JAK/STAT Signaling >
EGFR JAK Pim STAT
MAPK/ERK Pathway >
ERK JNK KLF MAP3K MAP4K MAPKAPK2 (MK2) MEK Mixed Lineage Kinase MNK p38 MAPK Raf Ribosomal S6 Kinase (RSK)
Membrane Transporter/Ion Channel >
ATP Synthase BCRP Calcium Channel CFTR Chloride Channel CRAC Channel CRM1 EAAT2 GABA Receptor GlyT HCN Channel iGluR Monoamine Transporter Monocarboxylate Transporter Na+/Ca2+ Exchanger Na+/HCO3- Cotransporter Na+/K+ ATPase nAChR NKCC P-glycoprotein P2X Receptor Potassium Channel Proton Pump SGLT Sodium Channel TRP Channel URAT1
Metabolic Enzyme/Protease >
15-PGDH 5 alpha Reductase 5-Lipoxygenase Acetyl-CoA Carboxylase Acyltransferase Adenosine Deaminase Adenosine Kinase Aldehyde Dehydrogenase (ALDH) Aldose Reductase Aminopeptidase Angiotensin-converting Enzyme (ACE) ATGL ATP Citrate Lyase Carbonic Anhydrase Carboxypeptidase Cathepsin CETP COMT Cytochrome P450 Dipeptidyl Peptidase Dopamine β-hydroxylase E1/E2/E3 Enzyme Elastase Enolase FAAH FABP Factor Xa Farnesyl Transferase Fatty Acid Synthase (FAS) FXR Glucokinase GSNOR Gutathione S-transferase HCV Protease Hexokinase HIF/HIF Prolyl-Hydroxylase HIV Integrase HIV Protease HMG-CoA Reductase (HMGCR) HSP Indoleamine 2,3-Dioxygenase (IDO) Isocitrate Dehydrogenase (IDH) Lactate Dehydrogenase LXR MAGL Mineralocorticoid Receptor Mitochondrial Metabolism MMP Nampt NEDD8-activating Enzyme Neprilysin PAI-1 PDHK PGC-1α Phosphatase Phosphodiesterase (PDE) Phospholipase Procollagen C Proteinase Proteasome Pyruvate Kinase RAR/RXR Renin ROR Ser/Thr Protease SGK Stearoyl-CoA Desaturase (SCD) Thrombin Tryptophan Hydroxylase Tyrosinase Xanthine Oxidase
Neuronal Signaling >
5-HT Receptor AChE Adenosine Kinase Amyloid-β Beta-secretase CaMK CGRP Receptor COMT Dopamine Receptor Dopamine Transporter FAAH GABA Receptor GlyT iGluR Imidazoline Receptor mAChR Melatonin Receptor Monoamine Oxidase nAChR Neurokinin Receptor Opioid Receptor Serotonin Transporter γ-secretase
NF-κB >
NF-κB IKK Keap1-Nrf2 MALT1
PI3K/Akt/mTOR >
Akt AMPK ATM/ATR DNA-PK GSK-3 MELK mTOR PDK-1 PI3K PI4K PIKfyve PTEN
PROTAC >
PROTAC E3 Ligase Ligand-Linker Conjugate Ligand for E3 Ligase PROTAC Linker PROTAC-linker Conjugate for PAC
Protein Tyrosine Kinase/RTK >
Ack1 ALK Bcr-Abl BMX Kinase Btk c-Fms c-Kit c-Met/HGFR Discoidin Domain Receptor DYRK EGFR Ephrin Receptor FAK FGFR FLT3 IGF-1R Insulin Receptor IRAK Itk PDGFR PKA Pyk2 ROS Src Syk TAM Receptor Trk Receptor VEGFR
Stem Cell/Wnt >
Casein Kinase ERK Gli GSK-3 Hedgehog Hippo (MST) JAK Notch Oct3/4 PKA Porcupine ROCK sFRP-1 Smo STAT TGF-beta/Smad Wnt YAP β-catenin γ-secretase
TGF-beta/Smad >
TGF-beta/Smad PKC ROCK TGF-β Receptor
Vitamin D Related >
VD/VDR
Others >
Androgen Receptor Aromatase Estrogen Receptor/ERR Progesterone Receptor Thyroid Hormone Receptor Others

Bepirovirsen

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

merimepodib

Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).

  • CAS Number: 198821-22-6
  • MF: C23H24N4O6
  • MW: 452.460
  • Catalog: HBV
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 571.4±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 299.4±30.1 °C

Schisanwilsonin H

Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity[1].

  • Density: 1.3±0.1 g/cm3
  • Boiling Point: 675.6±55.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 218.9±25.0 °C

H-PRO-ALA-LEU-PRO-GLU-ASP-GLY-GLY-SER-GLY-ALA-PHE-PRO-PRO-GLY-HIS-PHE-LYS-ASP-PRO-LYS-ARG-LEU-TYR-OH

Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research[1].

  • CAS Number: 211362-85-5
  • MF: C118H173N31O33
  • MW: 2553.824
  • Catalog: Bacterial
  • Density: 1.5±0.1 g/cm3
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

cetylpyridinium chloride

Cetylpyridinium chloride, a cationic quaternary ammonium compound, is an anti-bacterial agent with broad-spectrum activity. Cetylpyridinium chloride is an effective anti-HBV capsid assembly inhibitor with an IC50 of 2.5 μM. Cetylpyridinium chloride is used in pesticides and various types of mouthwashes, and other personal care products[1][2].

  • CAS Number: 123-03-5
  • MF: C21H38ClN
  • MW: 339.986
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: 77°C
  • Flash Point: N/A

Exbivirumab

Exbivirumab is an anti-HBV mAb. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG)[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

DVR-01

DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases[1].

  • CAS Number: 330461-34-2
  • MF: C20H23ClN2O3S
  • MW: 406.93
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

HBV-IN-23

HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC50 of 0.58 µM. HBV-IN-23 inhibits HBV DNA replication in both drug sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis[1].

  • CAS Number: 2413649-89-3
  • MF: C25H27N3O3S
  • MW: 449.57
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

HBV Seq1 aa:63-71

HBV Seq1 aa:63-71 is the fragment of hepatitis B virus (HBV)[1].

  • CAS Number: 189323-64-6
  • MF: C46H72N10O14S
  • MW: 1021.19
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Taribavirin hydrochloride

Taribavirin hydrochloride is an inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus[1]. Taribavirin hydrochloride is a Ribavirin prodrug, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia[2].

  • CAS Number: 40372-00-7
  • MF: C8H14ClN5O4
  • MW: 279.68100
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

HBV-IN-38

HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections[1].

  • CAS Number: 1834483-86-1
  • MF: C18H16F3N5O4S2
  • MW: 487.48
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Vebicorvir

Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM[1].

  • CAS Number: 2090064-66-5
  • MF: C19H12F3N3O4S2
  • MW: 467.44
  • Catalog: HBV
  • Density: 1.6±0.1 g/cm3
  • Boiling Point: 566.3±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 296.3±30.1 °C

alamifovir

Alamifovir (LY582563; MCC-478), a purine nucleotide analogue prodrug, shows potent activity against wild type and lamivudine resistant hepatitis B virus (HBV). Alamifovir has high activity against HBV replication and sustained antiviral effect[1][2].

  • CAS Number: 193681-12-8
  • MF: C19H20F6N5O5PS
  • MW: 575.42200
  • Catalog: HBV
  • Density: 1.61g/cm3
  • Boiling Point: 635.9ºC at 760mmHg
  • Melting Point: N/A
  • Flash Point: 338.4ºC

L-Fd4A

L-Fd4A is an adenine derivative. L-Fd4A has anti-human immunodeficiency virus (HIV) (EC50=1.5 μM) and anti-hepatitis B virus (HBV) (EC50=1.7 μM) activity. L-Fd4A has low cytotoxicity[1].

  • CAS Number: 210474-65-0
  • MF: C10H10FN5O2
  • MW: 251.22
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Mulberrofuran G

Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress[1]. Mulberrofuran G shows moderate inhibiting activity of hepatitis B virus (HBV) DNA replication with the

  • CAS Number: 87085-00-5
  • MF: C34H26O8
  • MW: 562.57
  • Catalog: HBV
  • Density: 1.5±0.1 g/cm3
  • Boiling Point: 695.1±55.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 374.2±31.5 °C

Fosclevudine alafenamide

Fosclevudine alafenamide (Compound EIDD-02173) is an antiviral agent with an EC50 of 1.71 μM against HBV[1].

  • CAS Number: 1951476-79-1
  • MF: C22H29FN3O9P
  • MW: 529.45
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside

Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside is an anti-hepatitis B virus (anti-HBV) agent. Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside inhibits HBV surface antigen (HBsAg) and HBV e antigen (HBeAg) secretion on Hep G2.2.15 cell line, with IC50 values of 1.67 and >2.15 mM, respectively[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

IR415

IR415 is a novel small molecule inhibitor of HBV virus replication that blocks hepatitis B virus X protein (HBx, Kd=2 nM) mediated RNAi suppression, reverses the inhibitory effect of HBx protein on activity of the Dicer endoribonuclease; exhibits a marked depletion of HBV core protein synthesis and down-regulation of pre-genomic HBV RNA in HBV-infected HepG2 cells, selectively targets HBx in a concentration-dependent manner.

  • CAS Number: 452967-14-5
  • MF: C13H14F2N4S
  • MW: 296.34
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

HBV-IN-34

HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC50 of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively[1].

  • CAS Number: 2716906-45-3
  • MF: C21H19F2N7
  • MW: 407.42
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Entecavir

Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.

  • CAS Number: 142217-69-4
  • MF: C12H15N5O3
  • MW: 277.279
  • Catalog: HBV
  • Density: 1.8±0.1 g/cm3
  • Boiling Point: 734.2ºC at 760 mmHg
  • Melting Point: 249-252ºC
  • Flash Point: 397.9ºC

Canocapavir

Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. [1].

  • CAS Number: 2137847-19-7
  • MF: C27H21BrFN5O3
  • MW: 562.39
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Yhhu6669

Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties[1].

  • CAS Number: 2569526-80-1
  • MF: C29H28ClFN6O3
  • MW: 563.02
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

JNJ-632

JNJ-632 is a hepatitis B virus (HBV) capsid assembly modulator (CAM).

  • CAS Number: 1572510-42-9
  • MF: C18H19FN2O4S
  • MW: 378.42
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

RIG-1 modulator 1

RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.

  • CAS Number: 1428729-63-8
  • MF: C14H17N5OS2
  • MW: 335.45
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

BA-53038B

BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly in a distinct manner, with an EC50 value of 3.32 μM[1].

  • CAS Number: 2306195-65-1
  • MF: C14H16ClNO
  • MW: 249.74
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Telbivudine

Telbivudine, a specific inhibitor of hepatitis B virus (HBV) replication, is an antiviral drug used in the treatment of hepatitis B infection.Target: HBVTelbivudine is an antiviral drug used in the treatment of hepatitis B infection. It is marketed by Swiss pharmaceutical company Novartis under the trade names Sebivo (Europe) and Tyzeka (United States). Clinical trials have shown it to be significantly more effective than lamivudine or adefovir, and less likely to cause resistance. Telbivudine is a synthetic thymidine nucleoside analogue, it is the L-isomer of thymidine. It is taken once daily.Telbivudine is a potent antiviral that provides effective and sustained viral suppression in patients with compensated CHB. In clinical trials, treatment outcomes were improved significantly more with telbivudine 600 mg once daily than with lamivudine 100 mg or adefovir 10 mg once daily, and telbivudine-treated patients had significantly less viral resistance than lamivudine-treated patients. Telbivudine is associated with a medium genetic barrier to resistance and, as patients with undetectable HBV DNA levels have significantly improved outcomes, it is recommended that HBV DNA levels are monitored at week 24 (and 6 monthly thereafter), with the addition of a nucleoside/nucleotide analogue without cross resistance (such as adefovir dipivoxil) if viraemia is present to reduce the risk of resistance (Roadmap concept). Telbivudine was generally well tolerated in clinical trials for periods of up to 4 years, and has a similar tolerability profile to that of lamivudine.

  • CAS Number: 3424-98-4
  • MF: C10H14N2O5
  • MW: 242.229
  • Catalog: HBV
  • Density: 1.5±0.1 g/cm3
  • Boiling Point: N/A
  • Melting Point: 188-190ºC
  • Flash Point: N/A

RG7834

RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Periglaucine A

Periglaucine A, a hasubanane-type alkaloid, can be isolated from Pericampylus glaucus. Periglaucine A can inhibits HBV surface antigen (HBsAg) secretion in Hep G2.2.15 cells. Periglaucine A also shows anti-HIV-1 activity in C8166 cells (EC50: 204 μM)[1].

  • CAS Number: 1025023-04-4
  • MF: C20H23NO6
  • MW: 373.400
  • Catalog: HBV
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 509.5±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 261.9±30.1 °C

L-2'-Fd4C

L-2'-Fd4C, is an l-nucleoside analogue. L-2'-Fd4C has anti-human immunodeficiency virus (HIV) and anti-hepatitis B virus (HBV) activity[1].

  • CAS Number: 221662-50-6
  • MF: C9H10FN3O3
  • MW: 227.19
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Xalnesiran sodium

Xalnesiran (sodium) is siRNA for the treatment of chronic hepatitis B (HBV)..

  • CAS Number: 2538784-49-3
  • MF: C664H814F17N231Na57O415P57S6
  • MW: 22262.12
  • Catalog: HBV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A