Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).
Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity[1].
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research[1].
Cetylpyridinium chloride, a cationic quaternary ammonium compound, is an anti-bacterial agent with broad-spectrum activity. Cetylpyridinium chloride is an effective anti-HBV capsid assembly inhibitor with an IC50 of 2.5 μM. Cetylpyridinium chloride is used in pesticides and various types of mouthwashes, and other personal care products[1][2].
Exbivirumab is an anti-HBV mAb. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG)[1].
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases[1].
HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC50 of 0.58 µM. HBV-IN-23 inhibits HBV DNA replication in both drug sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis[1].
HBV Seq1 aa:63-71 is the fragment of hepatitis B virus (HBV)[1].
Taribavirin hydrochloride is an inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus[1]. Taribavirin hydrochloride is a Ribavirin prodrug, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia[2].
HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections[1].
Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM[1].
Alamifovir (LY582563; MCC-478), a purine nucleotide analogue prodrug, shows potent activity against wild type and lamivudine resistant hepatitis B virus (HBV). Alamifovir has high activity against HBV replication and sustained antiviral effect[1][2].
L-Fd4A is an adenine derivative. L-Fd4A has anti-human immunodeficiency virus (HIV) (EC50=1.5 μM) and anti-hepatitis B virus (HBV) (EC50=1.7 μM) activity. L-Fd4A has low cytotoxicity[1].
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress[1]. Mulberrofuran G shows moderate inhibiting activity of hepatitis B virus (HBV) DNA replication with the
Fosclevudine alafenamide (Compound EIDD-02173) is an antiviral agent with an EC50 of 1.71 μM against HBV[1].
Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside is an anti-hepatitis B virus (anti-HBV) agent. Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside inhibits HBV surface antigen (HBsAg) and HBV e antigen (HBeAg) secretion on Hep G2.2.15 cell line, with IC50 values of 1.67 and >2.15 mM, respectively[1].
IR415 is a novel small molecule inhibitor of HBV virus replication that blocks hepatitis B virus X protein (HBx, Kd=2 nM) mediated RNAi suppression, reverses the inhibitory effect of HBx protein on activity of the Dicer endoribonuclease; exhibits a marked depletion of HBV core protein synthesis and down-regulation of pre-genomic HBV RNA in HBV-infected HepG2 cells, selectively targets HBx in a concentration-dependent manner.
HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC50 of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively[1].
Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. [1].
Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties[1].
JNJ-632 is a hepatitis B virus (HBV) capsid assembly modulator (CAM).
RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly in a distinct manner, with an EC50 value of 3.32 μM[1].
Telbivudine, a specific inhibitor of hepatitis B virus (HBV) replication, is an antiviral drug used in the treatment of hepatitis B infection.Target: HBVTelbivudine is an antiviral drug used in the treatment of hepatitis B infection. It is marketed by Swiss pharmaceutical company Novartis under the trade names Sebivo (Europe) and Tyzeka (United States). Clinical trials have shown it to be significantly more effective than lamivudine or adefovir, and less likely to cause resistance. Telbivudine is a synthetic thymidine nucleoside analogue, it is the L-isomer of thymidine. It is taken once daily.Telbivudine is a potent antiviral that provides effective and sustained viral suppression in patients with compensated CHB. In clinical trials, treatment outcomes were improved significantly more with telbivudine 600 mg once daily than with lamivudine 100 mg or adefovir 10 mg once daily, and telbivudine-treated patients had significantly less viral resistance than lamivudine-treated patients. Telbivudine is associated with a medium genetic barrier to resistance and, as patients with undetectable HBV DNA levels have significantly improved outcomes, it is recommended that HBV DNA levels are monitored at week 24 (and 6 monthly thereafter), with the addition of a nucleoside/nucleotide analogue without cross resistance (such as adefovir dipivoxil) if viraemia is present to reduce the risk of resistance (Roadmap concept). Telbivudine was generally well tolerated in clinical trials for periods of up to 4 years, and has a similar tolerability profile to that of lamivudine.
RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells[1].
Periglaucine A, a hasubanane-type alkaloid, can be isolated from Pericampylus glaucus. Periglaucine A can inhibits HBV surface antigen (HBsAg) secretion in Hep G2.2.15 cells. Periglaucine A also shows anti-HIV-1 activity in C8166 cells (EC50: 204 μM)[1].
L-2'-Fd4C, is an l-nucleoside analogue. L-2'-Fd4C has anti-human immunodeficiency virus (HIV) and anti-hepatitis B virus (HBV) activity[1].
Xalnesiran (sodium) is siRNA for the treatment of chronic hepatitis B (HBV)..